Kidney Res Clin Pract > Volume 31(4); 2012 > Article
Jung, Cho, Lim, Yu, Choi, Yoon, Park, Kim, and Kim: Impact of gene polymorphisms of interleukin-18, transforming growth factor-β, and vascular endothelial growth factor on development of IgA nephropathy and thin glomerular basement membrane disease

Abstract

Background

We investigated the effects of gene polymorphisms on the development of IgA nephropathy and thin glomerular basement membrane (GBM) disease by analyzing polymorphisms in the interleukin (IL)-18, transforming growth factor (TGF)-β, and vascular endothelial growth factor (VEGF) genes in Korean patients.

Methods

This study included 146 normal individuals and 69 biopsy-proven IgA nephropathy and 44 thin GBM disease patients. The gene polymorphisms −607 A/C and −137 G/C in IL-18, −509C/T and T869C in TGF-β, and −2578C/A and 405C/G in VEGF were investigated in DNA extracted from peripheral blood.

Results

The frequencies of the IL-18 −607CC genotype (43.5% vs. 21.2%, P=0.002, P corrected=0.012) and the VEGF 405 GG genotype (37.7% vs. 21.2%, P=0.002, P corrected=0.012) were significantly increased in the IgA nephropathy group compared with the control group, whereas no significant differences in genotype frequency were observed between the thin GBM disease and control groups. However, there were no significant differences in genotype and allele frequencies between the IgA nephropathy and thin GBM disease groups.

Conclusion

This study did not show any statistically significant differences of six selected gene polymorphisms of the IL-18, TGF-β, and VEGF genes between IgA nephropathy and thin GBM disease. Additional extensive studies are required to clarify the potential role of gene polymorphism to discriminate IgA nephropathy and thin GBM disease without renal biopsy.

Keywords

Hematuria, IgA glomerulonephritis, Interleukin-18, Single nucleotide polymorphism, Transforming growth factor-β1, Vascular endothelial growth factor

Introduction

IgA nephropathy and thin glomerular basement membrane (GBM) disease are representative glomerular diseases that cause asymptomatic hematuria [1]. Clinical progress of IgA nephropathy takes diverse forms ranging from reaching the clinical remission stage without treatment to the development of the terminal stage of renal failure. It was reported that approximately 30–50% of the IgA nephropathy patients reached the final stage of renal failure within 30 years [2]. Some of the patients with thin GBM disease were reported to have developed renal failure [3], but the prognosis is generally favorable [4]. Therefore, differential diagnosis of IgA nephropathy and thin GBM disease is an important part of determining the treatment method in patients with asymptomatic hematuria.
IgA nephropathy and thin GBM disease are generally diagnosed by renal biopsy. A characteristic of IgA nephropathy is that IgA deposition can be seen in the mesangium area in immunofluorescence microscopy. Deposition of electro-dense material in the mesangium or paramesangium areas can also be seen by electron microscopy [5]. The thickness of the glomerular basement membrane measured by electron microscopy, the criterion for the histological diagnosis of thin GBM disease, is known to be below 200–250 nm in children and below 250–264 nm in adults [6] depending on the age. Thin GBM disease is diagnosed when no deposition of immunoglobulin or complement is shown in immunofluorescence microscopy and there is a general decrease in the thickness of the GBM in at least 50% of the capillary loop [4].
The pathogenesis of IgA nephropathy is not clearly known yet. There are a number of studies that were based on the assumption that cytokines, control hormones produced during the active and effective phases of immunological reactions that transmit signals between cells [7], have a certain role in IgA nephropathy, but these reports have diverse results [8], [9]. Although the pathogenesis of thin GBM disease is not completely known yet, genetic abnormalities are suspected since there is a high tendency for familial association [4].
It has been reported in many studies that the genetic polymorphisms of interleukin (IL)-18, transforming growth factor (TGF)-β, and vascular endothelial growth factor (VEGF) were involved in the development and progression of a variety of glomerular diseases including IgA nephropathy [10], [11], [12], [13], [14], [15], [16]. However, cytokines are considered to have less effect on the development of thin GBM disease from a pathogenic point of view and there has been no study on cytokine gene polymorphisms. This study investigated the impact of different genetic polymorphisms on the development of IgA nephropathy and thin GBM disease and attempted to evaluate the potential of this approach for differential diagnosis between the two diseases by conducting the test for the genetic polymorphisms of IL-18, TGF-β, and VEGF in IgA nephropathy and thin GBM disease patients and normal individuals.

Methods

Patients

This was a case-control, cross-sectional study, performed in a single center. A total of 113 Korean patients among IgA nephropathy and thin GBM disease patients who underwent renal biopsy at the Kyungpook National University Hospital (Daegu, Korea) agreed to genotyping analysis and were recruited. The control group consisted of 146 unrelated, healthy Korean individuals with normal renal function, normotension, no known medical problems based on a health-screening questionnaire, and who agreed to genotyping analysis. The controls were enrolled from the health promotion center of the same institute as the patients. The present study was approved by the institutional review board of Kyungpook National University Hospital (KNUH 2011-04-010).

Genomic DNA extraction

Blood samples (3 mL) were collected in ethylenediaminetetra-acetic acid tubes, and genomic DNA was isolated from 200 μL of whole blood using the Fujifilm DNA whole blood kit S with the QuickGene-810 system (Fujifilm, Tokyo, Japan) according to the manufacturer‘s instructions. The extracted DNA was assessed for purity, yield, and concentration on a NanoDrop ND-1000 spectrophotometer (NanoDrop Technologies, Wilmington, DE, USA). Purity was monitored by the A260/280 ratio. The DNA was diluted to 10 ng/μL for a working solution, and the isolated DNA was stored at −20 °C.

Cytokine gene polymorphism typing

Polymerase chain reaction (PCR) and melting curve analyses were performed on a LightCycler480 (Roche Diagnostics, Penzberg, Germany). The primers and hybridization probes used in this study were designed using available reference sequences from the GenBank database by TIB-MOLBIOL (Berlin, Germany; Table 1). Real-time PCR was performed as previously described [11].

Statistical analysis

The results are expressed as the mean±standard deviation or frequencies. The Hardy-Weinberg equilibrium for each polymorphism was tested using the Chi-square test. The differences in allele frequency and genotype distribution between the two groups were assessed by Chi-square analysis. The odds ratio (OR) and 95% confidence interval (CI) were calculated. Logistic regression analysis was used to adjust for significantly different clinical variables. Statistical analyses were performed using SPSS 18.0 for Windows (SPSS Inc., Chicago, IL, USA). A P value<0.05 was considered significant. When multiple comparisons were involved, corrected P values were calculated for multiple testing by the Bonferroni method.

Results

This study included 146 normal subjects and 69 IgA nephropathy and 44 thin GBM disease patients. The mean age and the sex ratio were significantly different among the groups (P<0.001 and P<0.001, respectively). Significant differences between the IgA nephropathy and thin GBM disease groups were observed in all of the serum urea nitrogen (15.0±5.7 mg/dL vs. 12.4±3.1 mg/dL, P=0.006), serum creatinine (0.92±0.43 mg/dL vs. 0.73±0.16 mg/dL, P=0.005), glomerular filtration rate (107.8±42.7 mL/min/1.73 m2 vs. 125.5±37.1 mL/min/1.73 m2, P=0.026), and 24-hour proteinuria (1059.5±1580.2 mg/day vs. 272.5±472.1 mg/day, P=0.002; Table 2). The genotype frequencies of the patient and control groups did not deviate significantly from the Hardy–Weinberg equilibrium (P>0.05).
The frequencies of the IL-18 –607CC genotype showed a significant difference between the IgA nephropathy group and control group (43.5% vs. 21.2%, P=0.002, P corrected=0.012). The frequency of the –607A/C single nucleotide polymorphism (SNP) allele in IL-18 was investigated and A:C allele frequency ratio was 35.5:64.5 in the IgA nephropathy group and 53.1:46.9 in the control group showing a significant difference between the two groups (P=0.001, P corrected=0.006). In the recessive genetic analysis, the CC genotype was significantly more frequent in the IgA nephropathy group compared to the control group (43.5% vs. 21.2%, P=0.001, P corrected=0.006, OR=2.854, 95% CI 1.536–5.302; Table 3). The frequencies of the VEGF 405GG genotype were significantly increased in the IgA nephropathy group compared with the control group (37.7% vs. 21.2%, P=0.002, P corrected=0.012). Investigation of the allele frequency of the 405C/G SNP in VEGF showed the allele ratio of C:G as 39.1:60.9 in the IgA nephropathy group and 53.4:46.6 in the control group showing a significant difference between the two groups (P=0.006, P corrected=0.036). In the recessive genetic analysis, the GG genotype was significantly more frequent in the IgA nephropathy group compared to the control group (37.7% vs. 21.2%, P=0.001, P corrected=0.006, OR=2.243, 95% CI 1.197–4.203). There were no significant differences in the genotype and allele distributions of the investigated cytokine gene polymorphisms other than the IL-18 –607A/C and VEGF 405C/G (Table 3). Comparative analysis between the IgA nephropathy group and control group using age- and sex-adjusted logistic regression analysis showed a significant difference in the genotype and allele distribution of the –607A/C SNP in IL-18 and in the allele frequency of the 405C/G SNP in VEGF (Table 4).
The genotype distribution of the 405C/G SNP in VEGF between the thin GBM disease group and control group showed a significant difference (P=0.019). However, the difference became insignificant after correcting for multiple comparisons (P corrected=0.114). Significant differences could not be observed in the analysis of the dominant inheritance and regressive inheritance of the 405C/G SNP in VEGF. Investigation of the allele frequency of the 405C/G SNP in VEGF showed the allele ratio C:G as 36.4:63.6 in the thin GBM disease group and 53.4:46.6 in the control group, showing a significant difference between the two groups (P=0.005, P corrected=0.030, Table 5). However, after age- and sex-adjusted comparative analysis between the thin GBM disease group and control group using logistic regression analysis, the genotype distribution and allele frequency of the 405C/G SNP in VEGF did not show a significant difference (P corrected=0.126 and 0.114, respectively). There were no significant differences in the genotype and allele distributions of the investigated cytokine gene polymorphisms other than VEGF 405C/G.
In the comparison between the IgA nephropathy group and thin GBM disease group, the genotype distribution and allele frequency were not significantly different and age- and sex-adjusted results did not show any significant differences (Table 6). When the IgA nephropathy patients were compared with the thin GBM disease patients according to the level of proteinuria (<1.0 g/day vs. ≥1.0 g/day) or the glomerular filtration rate (<60 mL/min vs. ≥60 mL/min), no significant differences were observed in the genotype distributions of the investigated cytokine gene polymorphisms (data not shown).

Discussion

This study investigated the possible association of IL-18, TGF-β, and VEGF gene polymorphisms with the development of IgA nephropathy and thin GBM disease. The polymorphism in the IL-18 promoter at position –607 is associated with the development of IgA nephropathy, and the C allele at IL-18 –607A/C and the G allele at VEGF 405C/G seem to be associated with the development of IgA nephropathy and may be risk alleles. However, no significant difference in polymorphisms could be observed between the thin GBM disease group and control group. Comparison between the IgA nephropathy group and thin GBM disease group showed no significant difference in genotype distribution.
In a previous study, the associations of serum or urinary IL-18 levels with the development of glomerulonephritis have been reported [17], [18]. These findings indicate that IL-18 levels are associated with the activity and development of idiopathic nephrotic syndrome. Among the IL-18 polymorphisms, homozygous for C at position –607 and G at position –137 had higher levels of IL-18 mRNA compared to other genotypes [10]. Although we did not measure the serum or urine IL-18 levels in the present study, the IL-18 –607CC genotype, which was related with higher levels of IL-18 mRNA, was significantly more frequent in the IgA nephropathy group. This finding is in concordance with previous studies that found that a high IL-18 level was associated with the development of glomerulonephritis [17], [18].
The VEGF levels have been reported to be associated with the development and progression of glomerulonephritis [19]. The urinary VEGF level was correlated with baseline serum creatinine and erythrocyte sedimentation rate in glomerulonephritis patients. VEGF mRNA expression in peripheral blood mononuclear cells decreased in patients undergoing remission. VEGF expression analyses showed that the GG genotype at the 405 position of the VEGF promote region produced higher VEGF transcripts compared to the CC genotype [20]. Therefore, the VEGF 405GG genotype, which was significantly increased in the IgA patients in our study, might be associated with an increased risk of developing IgA nephropathy by producing higher VEGF transcripts than the other genotypes.
In our previous study, IL-18 and VEGF polymorphisms were associated with development of primary glomerulonephritis. In this study, 69% of glomerulonephritis was IgA nephropathy and the IL-18 –607CC genotype and VEGF 405GG genotype were associated with susceptibility to and the development of primary glomerulonephritis [11]. These data might reflect some associations between IgA nephropathy and IL-18 and VEGF polymorphisms.
However, our results could not further support that IL-18 and VEGF may be related to the progression of IgA nephropathy because no significant relationships were observed between the genotype distributions of IL-18 or VEGF, and the level of proteinuria or the glomerular filtration rate. Additional studies measuring serum and urine levels of IL-18 and VEGF and comparing histological grades are necessary to further clarify the potential roles of IL-18 and VEGF gene polymorphisms in the progression of IgA nephropathy.
The association of TGF-β –509CC and 869CC gene polymorphisms with IgA nephropathy has been reported in several studies [12], [13], [14], [15]. Taken together with the present study, TGF-β gene polymorphisms have been reported to be associated with the susceptibility of IgA nephropathy in some races, but there is still weak evidence to prove the association of TGF-β SNPs with IgA nephropathy in Asian populations. It is necessary to perform further extensive studies in various races to investigate the contribution of TGF-β SNPs to the susceptibility of IgA nephropathy.
The pathogenesis of thin GBM disease is known to be associated with an abnormality in type 4 collagen synthesis and many COL4A3 and COL4A4 mutations have been reported [21]. These mutations could cause a glycine substitution inhibiting the formation of the collagen trimer. We hypothesized that the genetic polymorphisms affecting cytokine expression would have less effect on the development of thin GBM disease than on IgA nephropathy. Comparing between the thin GBM disease and control groups, no significant difference could be observed in the genotype distributions and allele frequencies. This suggests that the genetic polymorphisms are not associated with the development of thin GBM disease. However, there was also no significant difference when the thin GBM disease group and IgA nephropathy group were compared. Since this may be due to the small number of thin GBM patients, further study is necessary that includes larger numbers of participants and measures cytokine concentrations in the serum or tissue.
Our study did have some limitations. First, the sample size of the phenotype groups was relatively small. Additional extensive studies are required to investigate the potential roles of cytokine gene polymorphisms to discriminate IgA nephropathy and thin GBM disease without renal biopsy. Second, we could not measure the serum or urine cytokine levels at the time of biopsy and gene expression of cytokines in peripheral blood mononuclear cells because of the cross-sectional study design. Further study comparing cytokine gene polymorphisms and measuring cytokine concentrations in serum or tissue might help to differentiate these two disease groups.
In the present study, the –607A/C IL-18 and 405C/G VEGF polymorphic variants, who might express higher levels of serum IL-18 and VEGF, had significantly higher frequency of IgA nephropathy compared to the other genotypes. Although no significant difference in the genotype distribution could be observed between the IgA nephropathy group and thin GBM disease group, this is the first study on the relationship between the development of thin GBM disease and cytokine gene polymorphisms.

Conflict of interest

No conflict of interest has been declared.

Acknowledgments

This study was supported by a grant from the Korea Healthcare Technology R & D Project, Ministry for Health, Welfare & Family Affair, Republic of Korea (A102065).

References

1. Julian BA, Waldo FB, Rifai A, Mestecky J. IgA nephropathy is the most common glomerulonephritis worldwide: a neglected disease in the United States? Kidney Int 84:1998;129–132.
2. Shen P, He L, Li Y, Wang Y, Chan M. Natural history and prognostic factors of IgA nephropathy presented with isolated microscopic hematuria in Chinese patients. Nephron Clin Pract 106:2007;157–161.
crossref
3. Dische FE, Weston MJ, Parsons V. Abnormally thin glomerular basement membranes associated with hematuria, proteinuria or renal failure in adults. Am J Nephrol 5:1985;103–109.
crossref pmid
4. Savige J, Rana K, Tonna S, Buzza M, Dagher H, Wang YY. Thin basement membrane nephropathy. Kidney Int 64:2003;1169–1178.
crossref pmid
5. Wang C, Liu X, Peng H, Tang Y, Tang H, Chen Z, Lou T, Zhang H. Mesangial cells stimulated by immunoglobulin A1 from IgA nephropathy upregulates transforming growth factor-beta1 synthesis in podocytes via renin-angiotensin system activation. ArchMed Res 41:2010;255–260.
crossref
6. Tiebosch AT, Frederik PM, van Breda Vriesman PJ, Mooy JM, van Rie H, van de Wiel TW, Wolters J, Zeppenfeldt E. Thin-basement-membrane nephropathy in adults with persistent hematuria. N Engl J Med 320:1989;14–18.
crossref pmid
7. Abbas AK, Lichtman AH, Pober JS. Cytokines. In: Abbas AK, Lichtman AH, Pober JS, Cellular and Molecular Immunology. 1997. WB Saunders; Philadelphia: p. 249–277.
8. Syrjänen J, Hurme M, Lehtimäki T, Mustonen J, Pasterneck A. Polymorphism of the cytokine genes and IgA nephropathy. Kidney Int 61:2002;1079–1085.
crossref pmid
9. Hsu SI, Ramirez SB, Winn MP, Bomventre JV, Owen WF. Evidence for genetic factors in the development and progression of IgA nephropathy. Kidney Int 57:2000;1818–1835.
crossref pmid
10. Giedraitis V, He B, Huang WX, Hillert J. Cloning and mutation analysis of the human IL-18 promotor: a possible role of polymorphism in expression regulation. J Neuroimmunol 112:2001;146–152.
pmid
11. Choi HJ, Cho JH, Kim JC, Seo HJ, Hyun SH, Kim GH, Choi JY, Choi HJ, Ryu HM, Cho JH, Park SH, Kim YL, Han S, Kim CD. Interleukin–18, transforming growth factor–ß1, and vascular endothelial growth factor gene polymorphisms and susceptibility to primary glomerulonephritis. Tissue Antigens 76:2010;289–296.
pmid
12. Sato F, Narita I, Goto S, Kondo D, Saito N, Ajiro J, Saga D, Ogawa A, Kadomura M, Akiyama F, Kaneko Y, Ueno M, Sakatsume M, Gejyo F. Transforming growth factor-beta1 gene polymorphism modifies the histological and clinical manifestations in Japanese patients with IgA nephropathy. Tissue Antigens 64:2004;35–42.
crossref pmid
13. Lim CS, Kim YS, Chae DW, Ahn C, Han JS, Kim S, Lee JS, Kim IS. Association of C-509T and T869C polymorphisms of transforming growth factor-beta1 gene with susceptibility to and progression of IgA nephropathy. Clin Nephrol 63:2005;61–67.
pmid
14. Carturan S, Roccatello D, Menegatti E, Di Simone D, Davit A, Piazza A, Sena LM, Matullo G. Association between transforming growth factor beta1 gene polymorphisms and IgA nephropathy. J Nephrol 17:2004;786–793.
pmid
15. Vuong MT, Lundberg S, Gunnarsson I, Wramner L, Seddighzadeh M, Hahn-Zoric M, Fernström A, Hanson LA, Do LT, Jacobson SH, Padyukov L. Genetic variation in the transforming growth factor-beta1 gene is associated with susceptibility to IgA nephropathy. Nephrol Dial Transplant 24:2009;3061–3067.
pmid pmc
16. Chow KM, Szeto CC, Lai FM, Poon P, Wong TY, Li PK. Genetic polymorphism of vascular endothelial growth factor: impact on progression of IgA nephropathy. Ren Fail 28:2006;15–20.
crossref pmid
17. Kiliś-Pstrusińska K, Medyńska A, Zwolińska D, Wawro A. Interleukin-18 in urine and serum of children with idiopathic nephrotic syndrome. Kidney Blood Press Res 31:2008;122–126.
crossref pmid
18. Matsumoto K, Kanmatsuse K. Augmented interleukin-18 production by peripheral blood monocytes in patients with minimal-change nephrotic syndrome. Am J Nephrol 21:2001;20–27.
crossref pmid pdf
19. Paydas S, Balal M, Tanriverdi K, Sertdemir Y, Baslamisli F. The relationship between the VEGF levels and VEGF mRNA expression and clinical course in different glomerulonephritis. Ren Fail 29:2007;779–784.
crossref pmid
20. van der Meer P, De Boer RA, White HL, van der Steege G, Hall AS, van Veldhuisen DJ. The VEGF +405 CC promoter polymorphism is associated with an impaired prognosis in patients with chronic heart failure: a MERIT-HF substudy. J Card Fail 11:2005;279–284.
crossref pmid
21. Buzza M, Dagher H, Wang YY, Wilson D, Babon JJ, Cotton RG, Savige J. Mutations in COL4A4 gene in thin basement membrane disease. Kidney Int 63:2003;447–453.
pmid
Table 1
Primer and hybridization probe sequences
Primer Sequence (5′→3′) Probe Size (bp) Annealing temp (°C)
IL-18
–607 A/C F: GTTGATACAGGCCATTAAGATT GAAAGTGTAAAAATTATTACATAAAATTCT- FL 295 49
R: CCCTAAATATATGTATCCTTAAATTG LCred640-ATGATGGTATCCGTGTGGCTTG-p
–137 G/C F: AGTGGCAGAGGATACGAG TCATGAAATCTTTTCTTCCGTAAAAGT- FL 121 52
R: AAGAGATACTCAGAAAGAGGTACA LCred640-GGGGCTCTGTGCCTTCCAAAA-p
TGF-β
–509C/T F: GTAAATTGGGGACAGTAAATGTATG TCCATCCCTCAGGTGTCC- FL 216 54
R: CTGGGAAACAAGGTAGGAGAA LCred640-GTTGCCCCCTCCTCCCACTGA-p
869 T/C F: ATCTAGGTTATTTCCGTGGGATAC CTGCTGCCGCTGCTGC FL 326 54
R: CAGCTCCATGTCGATAGTCTTG LCred640-CCGCTGCTGTGGCTACTGGTGCTGAC-p
VEGF
–2578C/A F: GAGGCTATGTCAGCTGTAGGTCA ACCCTGGCACGATCTGG- FL 225 66
R: CCTCCAACTCTCCACATCTTC LC640-GGATAATCAGACTGACTGGTCCCACTCTTC-p
405C/G F: TTGCCATTCCCCACTTGAA CGGTCACCCCCAAAAGCAGGTCAC- FL 327 68
R: CCGGGGAGGAGGTGGTA LCred640-CACTTTGCCCCTGTCCCTTTCG-p

F, forward primer; FL, fluorescence; IL-18, interleukin-18; p, phosphorylation; R, reverse primer; TGF-β, transforming growth factor-β; VEGF, vascular endothelial growth factor.

Table 2
Demographic characteristics of IgA nephropathy, thin GBM disease, and normal controls

IgA
Thin GBM
Normal
P
(n=69) (n=44) (n=146)
Age (y) 34.22±13.50 33.66±14.95 42.40±11.73 <0.001
Sex (male:female)   42:27   24:20 29:117 <0.001
Blood urea nitrogen (mg/dl) 14.98±5.70 12.38±3.11 0.006
Serum creatinine (mg/dl) 0.92±0.43 0.73±0.16 0.005
Estimated GFR 107.78±42.68 125.46±37.12 0.026
24-h proteinuria (mg/d) 1059.48±1580.17 272.45±472.12 0.002

Values are shown as mean±standard deviation.

GBM, glomerular basement membrane; GFR, glomerular filtration rate (calculated using Modification of Diet in Renal Disease formula).

Table 3
Cytokine genotype distributions (%) and allele frequencies in the IgA nephropathy and control groups
IL-18 –607A→C polymorphism
A/A A/C C/C P A allele C allele P
IgA 10 (14.5) 29 (42.0) 30 (43.5) 0.355 0.645
(n=69)
Control 40 (27.4) 75 (51.4) 31 (21.2) 0.002 (0.012) 0.531 0.469 0.001 (0.006)
(n=146)
Dominant effect (AA vs. AC+CC) 0.037 (0.222) OR 2.226, CI 1.039–4.773
Recessive effect (AA+AC vs. CC) 0.001 (0.006) OR 2.854, CI 1.536–5.302

IL-18 –137G→C polymorphism
G/G G/C C/C P G allele C allele P

IgA 53(76.8) 16 (23.2) 0 (0.0) 0.116 0.884
(n=69)
Control 111 (76.0) 30 (20.5) 5 (3.4) 0.352 0.863 0.137 0.545
(n=146)
Dominant effect (GG vs. GC+CC) 0.900 OR 1.044, CI 0.531–2.053
Recessive effect (GG+GC vs. CC) 0.179 OR 0.966, CI 0.937–0.996

TGF-β –509C→T polymorphism
C/C C/T T/T P C allele T allele P

IgA 14 (20.3) 35(50.7) 20 (29.0) 0.457 0.543
(n=69)
Control 43 (29.5) 63 (43.2) 40 (27.4) 0.347 0.510 0.490 0.298
(n=146)
Dominant effect (CC vs. CT+TT) 0.155 OR 1.640, CI 0.826–3.257
Recessive effect (CC+CT vs. TT) 0.808 OR 1.082, CI 0.573–2.040

TGF-β 869T→C polymorphism
T/T T/C C/C P T allele C allele P

IgA 12 (17.4) 36 (52.2) 21 (30.4) 0.565 0.435
(n=69)
Control 43 (29.5) 63 (43.2) 40 (27.4) 0.162 0.510 0.490 0.144
(n=146)
Dominant effect (TT vs. TC+CC) 0.057 OR 0.504, CI 0.246–1.033
Recessive effect (TT+TC vs. CC) 0.645 OR 0.863, CI 0.460–1.617

VEGF –2578C→A polymorphism
C/C C/A A/A P C allele A allele P

IgA 42 (60.9) 24 (34.8) 3 (4.3) 0.783 0.217
(n=69)
Control 82 (56.2) 56 (38.4) 8 (5.5) 0.795 0.753 0.247 0.296
(n=146)
Dominant effect (CC vs. CA+AA) 0.514 OR 1.214, CI 0.677–2.176
Recessive effect (CC+CA vs. AA) 1.000 OR 1.275, CI 0.328–4.964

VEGF 405C→G polymorphism
C/C C/G G/G P C allele G allele P

IgA 11 (15.9) 32 (46.4) 26 (37.7) 0.391 0.609
(n=69)
Control 41 (28.1) 74 (50.7) 31 (21.2) 0.002 (0.012) 0.534 0.466 0.006 (0.036)
(n=146)
Dominant effect (CC vs. CG+GG) 0.555 OR 1.188, CI 0.670–2.109
Recessive effect (CC+CG vs. GG) 0.001 (0.006) OR 2.243, CI 1.197–4.203

CI, 95% confidence interval; IL-18, interleukin-18; OR, odds ratio TGF-β, transforming growth factor-β; VEGF, vascular endothelial growth factor.

Prefers to genotype distribution.

Prefers to allele frequency; data were analyzed using the Chi-square test or Fisher‘s exact test as appropriate. P-values were Bonferroni corrected (blank) for multiple testing.

Table 4
Cytokine genotype distributions (%) and allele frequencies in the IgA nephropathy and control groups after age- and sex-adjusted logistic regression analysis
IgA nephropathy Control group P Odds ratio 95% CI
(n=69) (n=146)
IL-18 –607 A/C
 Genotype
  AA 10 (14.5%) 40 (27.4) 1
  AC 29 (42.0%) 75 (51.4) 0.387 1.491 0.604–3.684
  CC 30 (43.5%) 31 (21.2) 0.008 (0.048) 3.693 1.400–9.740
 Allele
  A 49 (35.5) 155 (53.1) 1
  C 89 (64.5) 137 (46.9) 0.005 (0.030) 1.993 1.237–3.209



IL-18–137 G/C
 Genotype
  GG 53 (76.8) 111 (76.0) 1
  GC 16 (23.2) 30 (20.5) 0.999
  CC 0 (0.0) 5 (3.4) 0.357 1.460 0.653–3.266
 Allele
  G 122 (88.4) 252 (86.3) 1
  C 16 (11.6) 40 (13.7) 0.683 0.865 0.432–1.733



TGF-β -509 C/T
 Genotype
  CC 14 (20.3) 43 (29.5) 1
  CT 35 (50.7) 63 (43.2) 0.081 2.108 0.912–4.871
  TT 20 (29.0) 40 (27.4) 0.172 1.900 0.756–4.773
 Allele
  C 63 (45.7) 149 (51.0) 1
  T 75 (54.3) 143 (49.0) 0.167 1.386 0.872–2.204



TGF-β 869 T/C
 Genotype
  TT 12 (17.4) 43 (29.5) 1
  TC 36 (52.2) 63 (43.2) 0.070 2.393 0.933–6.141
  CC 21 (30.4) 40 (27.4) 0.040 2.476 1.040–5.891
 Allele
  T 60 (43.5) 149 (51.0) 1
  C 78 (56.5) 143 (49.0) 0.070 1.538 0.966–2.451



VEGF -2578 C/A
 Genotype
  CC 42 (60.9) 82 (56.2) 1
  CA 24 (34.8) 56 (38.4) 0.940 1.059 0.243–4.619
  AA 3 (4.3) 8 (5.5) 0.590 0.827 0.414–1.650
 Allele
  C 108 (78.3) 220 (75.3) 1
  A 30 (21.7) 72 (24.7) 0.746 0.914 0.529–1.578



VEGF 405C/G
 Genotype
  CC 11 (15.9) 41 (28.1) 1
  CG 32 (46.4) 74 (50.7) 0.226 1.727 0.713–4.183
  GG 26 (37.7) 31 (21.2) 0.010 (0.060) 3.613 1.362–9.585
 Allele
  C 54 (39.1) 156 (53.4) 1
  G 84 (60.9) 136 (46.6) 0.008 (0.048) 1.885 1.179–3.015

CI, confidence interval; IL-18, interleukin-18; TGF-β, transforming growth factor-β; VEGF, vascular endothelial growth factor.

P-values were Bonferroni corrected (blank) for multiple testing.

Table 5
Cytokine genotype distributions (%) and allele frequencies in the thin GBM disease and control groups
IL-18 –607A→C polymorphism
A/A A/C C/C P A allele C allele P
Thin GBM 7 (15.9) 23(52.3) 14(31.8) 0.420 0.580
(n=44)
Control 40 (27.4) 75 (51.4) 31 (21.2) 0.182 0.531 0.469 0.069
(n=146)
Dominant effect (AA vs. AC+CC) 0.122 OR 1.995, CI 0.822–4.837
Recessive effect (AA+AC vs. CC) 0.148 OR 0.578, CI 0.273–1.221

IL-18 –137G→C polymorphism
G/G G/C C/C P G allele C allele P

Thin GBM 32(72.7) 11 (25.0) 1 (2.3) 0.852 0.148
(n=44)
Control 111 (76.0) 30 (20.5) 5 (3.4) 0.826 0.863 0.137 0.799
(n=146)
Dominant effect (GG vs. GC+CC) 0.657 OR 1.189, CI 0.554–2.555
Recessive effect (GG+GC vs. CC) 0.702 OR 1.525, CI 0.173–13.409

TGF-β –509C→T polymorphism
C/C C/T T/T P C allele T allele P

Thin GBM 12 (27.3) 21 (47.7) 11 (25.0) 0.511 0.489
(n=44)
Control 43 (29.5) 63 (43.2) 40 (27.4) 0.866 0.510 0.490 0.986
(n=146)
Dominant effect (CC vs. CT+TT) 0.780 OR 1.113, CI 0.524–2.364
Recessive effect (CC+CT vs. TT) 0.753 OR 1.132, CI 0.522–2.453

TGF-β 869T→C polymorphism
T/T T/C C/C P T allele C allele P

Thin GBM 12 (27.3) 21 (47.7) 11 (25.0) 0.511 0.489
(n=44)
Control 43 (29.5) 63 (43.2) 40 (27.4) 0.866 0.510 0.490 0.986
(n=146)
Dominant effect (TT vs. TC+CC) 0.780 OR 1.113, CI 0.524–2.364
Recessive effect (TT+TC vs. CC) 0.753 OR 1.132, CI 0.522–2.453

VEGF –2578C→A polymorphism
C/C C/A A/A P C allele A allele P

Thin GBM 26 (59.1) 17 (38.6) 1 (2.3) 0.784 0.216
(n=44)
Control 82 (56.2) 56 (38.4) 8 (5.5) 0.675 0.753 0.247 .555
(n=146)
Dominant effect (CC vs. CA+AA) 0.731 OR 0.887, CI 0.448–1.758
Recessive effect (CC+CA vs. AA) 0.687 OR 2.493, CI 0.303–20.496

VEGF 405C→G polymorphism
C/C C/G G/G P C allele G allele P

Thin GBM 5 (11.4) 22(50.0) 17 (38.6) 0.364 0.636
(n=44)
Control 41 (28.1) 74 (50.7) 31 (21.2) 0.019 (0.114) 0.534 0.466 0.005 (0.030)
(n=146)
Dominant effect (CC vs. CG+GG) 0.023 (0.138) OR 3.046, CI 1.122–8.267
Recessive effect (CC+CG vs. GG) 0.020 (0.120) OR 0.428, CI 0.207–0.884

CI, 95% confidence interval; GBM, glomerular basement membrane; IL-18, interleukin-18; OR, odds ratio; TGF-β, transforming growth factor-β; VEGF, vascular endothelial growth factor.

P refers to genotype distribution;

P refers to allele frequency; data were analyzed using the chi-square test or Fisher‘s exact test as appropriate; P-values were Bonferroni corrected (blank) for multiple testing.

Table 6
Cytokine genotype distributions (%) and allele frequencies in the IgA nephropathy and thin GBM groups
IL-18 –607 A→C polymorphism
A/A A/C C/C P A allele C allele P
IgA 10 (14.5) 29 (42.0) 30 (43.5) 0.355 0.645
(n=69)
Thin GBM 7 (15.9) 23(52.3) 14 (31.8) 0.452 0.420 0.580 .324
(n=44)
Dominant effect (AA vs. AC+CC) 0.837 OR 0.896, CI 0.314–2.599
Recessive effect (AA+AC vs. CC) 0.215 OR 1.648, CI 0.746–3.643

IL-18 –137 G→C polymorphism
G/G G/C C/C P G allele C allele P

IgA 53(76.8) 16 (23.2) 0 (0.0) 0.116 0.884
(n=69)
Thin GBM 32(72.7) 11 (25.0) 1 (2.3) 0.435 0.852 0.148 0.486
(n=44)
Dominant effect (GG vs. GC+CC) 0.624 OR 1.242, CI 0.522–2.958
Recessive effect (GG+GC vs. CC) 0.028 OR 1.023, CI 0.978–1.070

TGF-β –509C→T polymorphism
C/C C/T T/T P C allele T allele P

IgA 14 (20.3) 35(50.7) 20 (29.0) 0.457 0.543
(n=69)
Thin GBM 12 (27.3) 21 (47.7) 11 (25.0) 0.679 0.511 0.489 0.421
(n=44)
Dominant effect (CC vs. CT+TT) 0.390 OR 0.679, CI 0.280–1.646
Recessive effect (CC+CT vs. TT) 0.643 OR 1.224, CI 0.519–2.888

TGF-β 869 T→C polymorphism
T/T T/C C/C P T allele C allele P

IgA 12 (17.4) 36 (52.2) 21 (30.4) 0.565 0.435
(n=69)
Thin GBM 12 (27.3) 21 (47.7) 11 (25.0) 0.445 0.511 0.489 0.260
(n=44)
Dominant effect (TT vs. TC+CC) 0.210 OR 0.561, CI 0.226–1.394
Recessive effect (TT+TC vs. CC) 0.532 OR 1.313, CI 0.559–3.082

VEGF –2578C→A polymorphism
C/C C/A A/A P C allele A allele P

IgA 42 (60.9) 24 (34.8) 3 (4.3) 0.783 0.217
(n=69)
Thin GBM 26 (59.1) 17 (38.6) 1 (2.3) 0.445 0.784 0.216 0.979
(n=44)
Dominant effect (CC vs. CA+AA) 0.210 OR 1.077, CI 0.498–2.329
Recessive effect (CC+CA vs. AA) 0.532 OR 3.359, CI 0.379–29.674

VEGF 405C→G polymorphism
C/C C/G G/G P C allele G allele P

IgA 11 (15.9) 32 (46.4) 26 (37.7) 0.391 0.609
(n=69)
Thin GBM 5 (11.4) 22(50.0) 17 (38.6) 0.798 0.364 0.636 0.670
(n=44)
Dominant effect (CC vs. CG+GG) 0.496 OR 1.479, CI 0.477–4.590
Recessive effect (CC+CG vs. GG) 0.919 OR 0.963, CI 0.441–2.091

CI, 95% confidence interval; GBM, glomerular basement membrane; IL-18, interleukin-18; OR, odds ratio; TGF-β, transforming growth factor-β; VEGF, vascular endothelial growth factor.

P refers to genotype distribution;

P refers to allele frequency; data were analyzed using the Chi-square test or Fisher‘s exact test as appropriate.

TOOLS
METRICS Graph View
  • 5 Crossref
  • 8 Scopus
  • 4,334 View
  • 20 Download
Related articles


ABOUT
BROWSE ARTICLES
EDITORIAL POLICY
FOR CONTRIBUTORS
Editorial Office
#301, (Miseung Bldg.) 23, Apgujenog-ro 30-gil, Gangnam-gu, Seoul 06022, Korea
Tel: +82-2-3486-8736    Fax: +82-2-3486-8737    E-mail: registry@ksn.or.kr                

Copyright © 2026 by The Korean Society of Nephrology.

Developed in M2PI

Close layer